circad | circRNAs associated with diseases

Circ_0078767
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Non small cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	30507050
Experimental Method
Sample Type	Tissue and cell lines	Comparison	NSCLC tissues than that in adjacent tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCCTAGCTGTCAAGGAGTGG Reverse TCTAGAGATGCGCCAACACC	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Chen, T, Yang, Z, Liu, C, Wang, L, Yang, J, Chen, L, Li, W (2019). Circ_0078767 suppresses non-small-cell lung cancer by protecting RASSF1A expression via sponging miR-330-3p. Cell Prolif., 52, 2:e12548.